Review



pperk  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Cell Signaling Technology Inc pperk
    Pperk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 935 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pperk/Phospho-PERK+(Thr980)+Rabbit+mAb/bio_rxiv__64898__2026__03__02__708596-51-36-37
    Average 96 stars, based on 935 article reviews
    pperk - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors
    Article Snippet: .. For Western blots, the following antibodies were used at a dilution of 1:1000: eIF4A1 (abcam 31217), eIF4A2 (abcam 31218), pmTORC1 (Cell signalling 2971), pPERK (cell signalling 3179), ATF4 (Cell signalling 11815), pAKT (Cell signalling 3787), pERK1/2 (Cell signalling 9106), ERK1/2 (Sigma M5670) GAPDH (Sigma G8795), β-actin (Sigma A1978), p21 (Abcam ab107099), p16 (Abcam ab211542) .. Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

    Article Title:
    Article Snippet: .. The knowledge of MITF acetylation status (or the acetylation mimetics or non acetylable mimetics) cannot bias: group allocation (all mutants/K206-acetylated were subjected to identical investigation using fluorescence anisotropy, single molecule tracking and ChIP-seq), participants expectation (Fish embryo did not get to choose which plasmids they received) or observer bias (cell line for the SMT experiment, movie acquisitions and data analyses were conducts by three independent investigators located in two different countries). anti-HA (clone 12CA5) Supplier: Roche Catalog Number: 11666606001; RRID: AB_514506 Application: ChIP-seq Dilution: 120!g per ChIP-seq sample Application: Western blot Dilution: 1/10,000 anti-HA (clone HA-7) Supplier: Sigma-Aldrich Catalog Number: H3663; RRID: AB_262051 Application: Western blot Dilution: 1/5000 anti-HA (Clone 6E2) Supplier: Cell Signaling Technology Catalog Number: 2367; RRID: AB_2314619 Application: Western blot Dilution: 1/5000 anti-Acetylated-Lysine Supplier: Cell Signaling Technology Catalog Number: 9441; RRID: AB_331805 Application: Western blot Dilution: 1/1000 anti-MITF (Clone C5) Supplier: Millipore Catalog Number: MAB3747; RRID: AB_570596 Application: Western blot Dilution: 1/2000 anti-ERK 2 (Clone K-23) Supplier: Santa Cruz Biotechnology Catalog Number: sc-153; RRID: AB_2141293 Application: Western blot Dilution: 1/10,000 anti-ERK 2 (Clone D-2) Supplier: Santa Cruz Biotechnology Catalog Number: sc-1647; RRID: AB_627547 Application: Western blot Dilution: 1/3000 anti-Thr202/Tyr204, ppERK (Clone 197G2) Supplier: Cell Signaling Technology Catalog Number: 4377; RRID: AB_331775 Application: Western blot Dilution: 1/1000 anti-GAPDH (Clone 6C5) Supplier: Santa Cruz Biotechnology Catalog Number: sc-32233; RRID: AB_627679 Application: Western blot Dilution: 1/10,000 anti-GFP Supplier: Abcam Catalog Number: ab290 (RRID:AB_303395) Application: Western blot Dilution: 1/10,000 anti-Vinculin (clone VLN01) Supplier: ThermoFisher Scientific Catalog Number: MA5-11690; RRID: AB_10976821 Application: Western blot Dilution: 1/10,000 anti-Donkey Anti-Mouse IgG (H+L) Antibody, Alexa Fluor 488 Conjugated Supplier: ThermoFisher Scientific Catalog Number: A-21202 RRID:AB_141607 Application: Fluorescence Western blot Dilution: 1/3000 anti-Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 Supplier: ThermoFisher Scientific Catalog Number: A10040 RRID:AB_2534016 Application: Fluorescence Western blot Dilution: 1/3000 anti-MITF-K206Ac - In house Application: Western blot Dilution: 1/1,000 anti-HA Validation information: We previously published the result of HA ChIP-seq in non HA-tag expressing 501mel melanoma cell line (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE77437). ..

    Article Title: ADAR1-dependent RNA editing promotes MET and iPSC reprogramming by alleviating ER stress
    Article Snippet: Protein extracts were resolved in NovexWedgeWell 4–20% Tris-Glycine Gels (Invitrogen, XP04205BOX). .. The following antibodies were used for blotting: ACTB (Santa Cruz, sc-47778), ATF6α (Santa Cruz, sc-22799), β-TUBULIN (Santa Cruz, sc-55529), CDH1 (BD Biosciences, 610182), CDH2 (Santa Cruz, sc-393933), CHOP (Santa Cruz, sc-793), c-FOS (Santa Cruz, sc-52), c-JUN (Santa Cruz, sc-74543), MDA5 (ProteinTech, 21775–1-AP), NANOG (Bethyl Laboratories, A300–397A), pEIF2α (Santa Cruz, sc-101670), pIRE (Abcam, ab48187), PERK (Cell Signaling, #31925) and pPERK (Cell Signaling, #3179), For Western Blotting quantification, autoradiographic films were scanned and the band signal was quantified by densitometry using the Image-J-1.33 software (NIH; Bethesda, MD, USA). ..

    Article Title: Heat stress releases arachidonic acid to induce autophagy in Sertoli cells by enhancing ROS-mitochondrial-endoplasmic reticulum stress axis
    Article Snippet: .. Western Blot analysis and immuno uorescence analysis were conducted using the following primary antibodies: Claudin 11, Complex , , and (oxphos) and p-IRE1α (Thermo Fisher, Cat# 36-4500, 45-8099 and PA1-16927), Claudin 5 (Abcam, Cat# ab131259), p-ERK1/2 and pPERK (CST, Cat# 4377, 3179 ), ERK1/2 (CST, Cat# 9102 ), HSP60 and PINK1(CST, Cat# 12165, 2132) p-JNK, JNK, p-P38MAPK, P38MAPK, IRE1α, PERK and ATF6 α (Santa Cruz, Cat# sc-6254, sc-7345, sc-7973, sc-7972, sc-390960, sc-377400 and sc-166659), Lamin β1, LC3 and P62/SQSTM1 (Proteintech, Cat# 12987-1-AP, 18725-1-AP, 18420-1-AP), Alexa Fluor 488 Anti-Mouse /Rabbit IgG (Elabscience, Cat# E-AB-1056), Alexa Fluor 594 Anti-Mouse/Rabbit IgG (Elabscience, Cat# E-AB-1060). ..

    Fluorescence:

    Article Title:
    Article Snippet: .. The knowledge of MITF acetylation status (or the acetylation mimetics or non acetylable mimetics) cannot bias: group allocation (all mutants/K206-acetylated were subjected to identical investigation using fluorescence anisotropy, single molecule tracking and ChIP-seq), participants expectation (Fish embryo did not get to choose which plasmids they received) or observer bias (cell line for the SMT experiment, movie acquisitions and data analyses were conducts by three independent investigators located in two different countries). anti-HA (clone 12CA5) Supplier: Roche Catalog Number: 11666606001; RRID: AB_514506 Application: ChIP-seq Dilution: 120!g per ChIP-seq sample Application: Western blot Dilution: 1/10,000 anti-HA (clone HA-7) Supplier: Sigma-Aldrich Catalog Number: H3663; RRID: AB_262051 Application: Western blot Dilution: 1/5000 anti-HA (Clone 6E2) Supplier: Cell Signaling Technology Catalog Number: 2367; RRID: AB_2314619 Application: Western blot Dilution: 1/5000 anti-Acetylated-Lysine Supplier: Cell Signaling Technology Catalog Number: 9441; RRID: AB_331805 Application: Western blot Dilution: 1/1000 anti-MITF (Clone C5) Supplier: Millipore Catalog Number: MAB3747; RRID: AB_570596 Application: Western blot Dilution: 1/2000 anti-ERK 2 (Clone K-23) Supplier: Santa Cruz Biotechnology Catalog Number: sc-153; RRID: AB_2141293 Application: Western blot Dilution: 1/10,000 anti-ERK 2 (Clone D-2) Supplier: Santa Cruz Biotechnology Catalog Number: sc-1647; RRID: AB_627547 Application: Western blot Dilution: 1/3000 anti-Thr202/Tyr204, ppERK (Clone 197G2) Supplier: Cell Signaling Technology Catalog Number: 4377; RRID: AB_331775 Application: Western blot Dilution: 1/1000 anti-GAPDH (Clone 6C5) Supplier: Santa Cruz Biotechnology Catalog Number: sc-32233; RRID: AB_627679 Application: Western blot Dilution: 1/10,000 anti-GFP Supplier: Abcam Catalog Number: ab290 (RRID:AB_303395) Application: Western blot Dilution: 1/10,000 anti-Vinculin (clone VLN01) Supplier: ThermoFisher Scientific Catalog Number: MA5-11690; RRID: AB_10976821 Application: Western blot Dilution: 1/10,000 anti-Donkey Anti-Mouse IgG (H+L) Antibody, Alexa Fluor 488 Conjugated Supplier: ThermoFisher Scientific Catalog Number: A-21202 RRID:AB_141607 Application: Fluorescence Western blot Dilution: 1/3000 anti-Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 Supplier: ThermoFisher Scientific Catalog Number: A10040 RRID:AB_2534016 Application: Fluorescence Western blot Dilution: 1/3000 anti-MITF-K206Ac - In house Application: Western blot Dilution: 1/1,000 anti-HA Validation information: We previously published the result of HA ChIP-seq in non HA-tag expressing 501mel melanoma cell line (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE77437). ..

    Chromatin Immunoprecipitation:

    Article Title:
    Article Snippet: .. The knowledge of MITF acetylation status (or the acetylation mimetics or non acetylable mimetics) cannot bias: group allocation (all mutants/K206-acetylated were subjected to identical investigation using fluorescence anisotropy, single molecule tracking and ChIP-seq), participants expectation (Fish embryo did not get to choose which plasmids they received) or observer bias (cell line for the SMT experiment, movie acquisitions and data analyses were conducts by three independent investigators located in two different countries). anti-HA (clone 12CA5) Supplier: Roche Catalog Number: 11666606001; RRID: AB_514506 Application: ChIP-seq Dilution: 120!g per ChIP-seq sample Application: Western blot Dilution: 1/10,000 anti-HA (clone HA-7) Supplier: Sigma-Aldrich Catalog Number: H3663; RRID: AB_262051 Application: Western blot Dilution: 1/5000 anti-HA (Clone 6E2) Supplier: Cell Signaling Technology Catalog Number: 2367; RRID: AB_2314619 Application: Western blot Dilution: 1/5000 anti-Acetylated-Lysine Supplier: Cell Signaling Technology Catalog Number: 9441; RRID: AB_331805 Application: Western blot Dilution: 1/1000 anti-MITF (Clone C5) Supplier: Millipore Catalog Number: MAB3747; RRID: AB_570596 Application: Western blot Dilution: 1/2000 anti-ERK 2 (Clone K-23) Supplier: Santa Cruz Biotechnology Catalog Number: sc-153; RRID: AB_2141293 Application: Western blot Dilution: 1/10,000 anti-ERK 2 (Clone D-2) Supplier: Santa Cruz Biotechnology Catalog Number: sc-1647; RRID: AB_627547 Application: Western blot Dilution: 1/3000 anti-Thr202/Tyr204, ppERK (Clone 197G2) Supplier: Cell Signaling Technology Catalog Number: 4377; RRID: AB_331775 Application: Western blot Dilution: 1/1000 anti-GAPDH (Clone 6C5) Supplier: Santa Cruz Biotechnology Catalog Number: sc-32233; RRID: AB_627679 Application: Western blot Dilution: 1/10,000 anti-GFP Supplier: Abcam Catalog Number: ab290 (RRID:AB_303395) Application: Western blot Dilution: 1/10,000 anti-Vinculin (clone VLN01) Supplier: ThermoFisher Scientific Catalog Number: MA5-11690; RRID: AB_10976821 Application: Western blot Dilution: 1/10,000 anti-Donkey Anti-Mouse IgG (H+L) Antibody, Alexa Fluor 488 Conjugated Supplier: ThermoFisher Scientific Catalog Number: A-21202 RRID:AB_141607 Application: Fluorescence Western blot Dilution: 1/3000 anti-Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 546 Supplier: ThermoFisher Scientific Catalog Number: A10040 RRID:AB_2534016 Application: Fluorescence Western blot Dilution: 1/3000 anti-MITF-K206Ac - In house Application: Western blot Dilution: 1/1,000 anti-HA Validation information: We previously published the result of HA ChIP-seq in non HA-tag expressing 501mel melanoma cell line (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE77437). ..

    other:


    Software:

    Article Title: ADAR1-dependent RNA editing promotes MET and iPSC reprogramming by alleviating ER stress
    Article Snippet: Protein extracts were resolved in NovexWedgeWell 4–20% Tris-Glycine Gels (Invitrogen, XP04205BOX). .. The following antibodies were used for blotting: ACTB (Santa Cruz, sc-47778), ATF6α (Santa Cruz, sc-22799), β-TUBULIN (Santa Cruz, sc-55529), CDH1 (BD Biosciences, 610182), CDH2 (Santa Cruz, sc-393933), CHOP (Santa Cruz, sc-793), c-FOS (Santa Cruz, sc-52), c-JUN (Santa Cruz, sc-74543), MDA5 (ProteinTech, 21775–1-AP), NANOG (Bethyl Laboratories, A300–397A), pEIF2α (Santa Cruz, sc-101670), pIRE (Abcam, ab48187), PERK (Cell Signaling, #31925) and pPERK (Cell Signaling, #3179), For Western Blotting quantification, autoradiographic films were scanned and the band signal was quantified by densitometry using the Image-J-1.33 software (NIH; Bethesda, MD, USA). ..



    Similar Products

    94
    MedChemExpress anti pperk
    Anti Pperk, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pperk/Phospho-PERK+(Thr980)+Antibody/pm41896889-102-33-35
    Average 94 stars, based on 1 article reviews
    anti pperk - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology anti pperk sc32599
    Anti Pperk Sc32599, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pperk/GADD+153+Antibody/pm41844629-247-0-13
    Average 96 stars, based on 1 article reviews
    anti pperk sc32599 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc pperk
    Pperk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pperk/Phospho-PERK+(Thr980)+Rabbit+mAb/bio_rxiv__64898__2026__03__02__708596-51-36-37
    Average 96 stars, based on 1 article reviews
    pperk - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc anti pperk
    Anti Pperk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pperk/pm41596608-269-10-18
    Average 86 stars, based on 1 article reviews
    anti pperk - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    94
    MedChemExpress pperk
    Pperk, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pperk/Phospho-PERK+Antibody/pm40684638-269-24-26
    Average 94 stars, based on 1 article reviews
    pperk - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    90
    Cell Signaling Technology Inc anti-pperk
    Anti Pperk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pperk/anti+erk/pmc11441506__pnas__2400531121__sapp-44-73-74
    Average 90 stars, based on 1 article reviews
    anti-pperk - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc antibodies against pperk
    SB supplement ameliorated TMAO-mediated activation of ER stress signaling and dysregulation of ionic signaling. (A) and (B) Representative images and statistical data show the expression of <t>pPERK,</t> <t>PERK,</t> <t>pIRE1α,</t> IRE1α, pNF-κB, NF-κB, pIP3R, IP3R, NCX, Kv1.5, and β-actin in HL-1 cells from control group (n = 3), TMAO treated (n = 3), SB treated (n = 3), and TMAO combined with SB treated group (n = 3) in three independent experiments. β-Actin was used as a loading control. * P < 0.05. ** P < 0.01. TMAO versus control or SB or TMAO combined with SB treatment.
    Antibodies Against Pperk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pperk/Phospho-PERK+(Thr980)+Rabbit+mAb/pmc12225905-71-8-12
    Average 96 stars, based on 1 article reviews
    antibodies against pperk - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results


    SB supplement ameliorated TMAO-mediated activation of ER stress signaling and dysregulation of ionic signaling. (A) and (B) Representative images and statistical data show the expression of pPERK, PERK, pIRE1α, IRE1α, pNF-κB, NF-κB, pIP3R, IP3R, NCX, Kv1.5, and β-actin in HL-1 cells from control group (n = 3), TMAO treated (n = 3), SB treated (n = 3), and TMAO combined with SB treated group (n = 3) in three independent experiments. β-Actin was used as a loading control. * P < 0.05. ** P < 0.01. TMAO versus control or SB or TMAO combined with SB treatment.

    Journal: Journal of Advanced Research

    Article Title: Short-chain fatty acid butyrate against TMAO activating endoplasmic-reticulum stress and PERK/IRE1-axis with reducing atrial arrhythmia

    doi: 10.1016/j.jare.2024.08.009

    Figure Lengend Snippet: SB supplement ameliorated TMAO-mediated activation of ER stress signaling and dysregulation of ionic signaling. (A) and (B) Representative images and statistical data show the expression of pPERK, PERK, pIRE1α, IRE1α, pNF-κB, NF-κB, pIP3R, IP3R, NCX, Kv1.5, and β-actin in HL-1 cells from control group (n = 3), TMAO treated (n = 3), SB treated (n = 3), and TMAO combined with SB treated group (n = 3) in three independent experiments. β-Actin was used as a loading control. * P < 0.05. ** P < 0.01. TMAO versus control or SB or TMAO combined with SB treatment.

    Article Snippet: Additionally, the atrial sections were incubated with primary antibodies against pPERK (#3179, Cell Signaling Technology), pIRE1α (NB100-2323, Novus), and pNF-κB (ab86299, Abcam).

    Techniques: Activation Assay, Expressing, Control

    SB supplement ameliorated TMAO-mediated overexpression of ER stress signaling and pNF-κB in HL-1 cells. (A) and (B) show the representative images and statistical data of pPERK, pIRE1α, pNF-κB, and ER marker-Calnexin expression in HL-1 cells through cellular immunostaing assay in control group (n = 3), TMAO treated (n = 3), SB treated (n = 3), and TMAO combined with SB treated group (n = 3) in three independent experiments. (bar, 25 μm). ** P < 0.01. TMAO versus control or SB or TMAO combined with SB treatment.

    Journal: Journal of Advanced Research

    Article Title: Short-chain fatty acid butyrate against TMAO activating endoplasmic-reticulum stress and PERK/IRE1-axis with reducing atrial arrhythmia

    doi: 10.1016/j.jare.2024.08.009

    Figure Lengend Snippet: SB supplement ameliorated TMAO-mediated overexpression of ER stress signaling and pNF-κB in HL-1 cells. (A) and (B) show the representative images and statistical data of pPERK, pIRE1α, pNF-κB, and ER marker-Calnexin expression in HL-1 cells through cellular immunostaing assay in control group (n = 3), TMAO treated (n = 3), SB treated (n = 3), and TMAO combined with SB treated group (n = 3) in three independent experiments. (bar, 25 μm). ** P < 0.01. TMAO versus control or SB or TMAO combined with SB treatment.

    Article Snippet: Additionally, the atrial sections were incubated with primary antibodies against pPERK (#3179, Cell Signaling Technology), pIRE1α (NB100-2323, Novus), and pNF-κB (ab86299, Abcam).

    Techniques: Over Expression, Marker, Expressing, Control

    SB supplement ameliorated atrial fibrosis and PERK/IRE1α/NF-κB axis of TMAO-treated mice. The expression of atrial fibrosis (blue area) was detected by Masson's staining and immunostaining of pPERK, pIRE1α, and pNF-κB in the atrium tissues derived from mice gavage with control (n = 5), TMAO (n = 5), and TMAO combined with SB (n = 5). The expressions of pPERK are indicated by hollow arrowheads. (bar, 25 μm). ** p < 0.01. TMAO treatment versus control group or TMAO combined with SB treated group. (For interpretation of the references to colour in this Fig. legend, the reader is referred to the web version of this article.)

    Journal: Journal of Advanced Research

    Article Title: Short-chain fatty acid butyrate against TMAO activating endoplasmic-reticulum stress and PERK/IRE1-axis with reducing atrial arrhythmia

    doi: 10.1016/j.jare.2024.08.009

    Figure Lengend Snippet: SB supplement ameliorated atrial fibrosis and PERK/IRE1α/NF-κB axis of TMAO-treated mice. The expression of atrial fibrosis (blue area) was detected by Masson's staining and immunostaining of pPERK, pIRE1α, and pNF-κB in the atrium tissues derived from mice gavage with control (n = 5), TMAO (n = 5), and TMAO combined with SB (n = 5). The expressions of pPERK are indicated by hollow arrowheads. (bar, 25 μm). ** p < 0.01. TMAO treatment versus control group or TMAO combined with SB treated group. (For interpretation of the references to colour in this Fig. legend, the reader is referred to the web version of this article.)

    Article Snippet: Additionally, the atrial sections were incubated with primary antibodies against pPERK (#3179, Cell Signaling Technology), pIRE1α (NB100-2323, Novus), and pNF-κB (ab86299, Abcam).

    Techniques: Expressing, Staining, Immunostaining, Derivative Assay, Control